Polymorphism in Plasmodium falciparum Erythrocyte-binding Antigen 175 (PfEBA-175) Region III from Timika Papua Isolate

• Main Author: NADHIROH (NIM : 10513038), AINUN
• Format: Final Project
• Language: Indonesia
• Online Access: https://digilib.itb.ac.id/gdl/view/25229
• Institution: Institut Teknologi Bandung

<p align="justify">Plasmodium falciparum Erythrocyte-binding Antigen 175 (PfEBA-175) has been identified role in Plasmodium invasion process with glycohorin A on the surface of Red Blood Cells. Therefore, EBA-175 can be used as targets for vaccine development or malaria treatment. EBA-175 consists of 6 extracellular regions, which the region II has been widely studied and identified. The functional role of regions III–V still unclear. Based on previous research, the antibodies concentration needed to protect region III less than region II, so immunization against region III will more effective and can be used as antigen vaccine candidates. However, region III of EBA-175 is highly polymorphic, so that it was needed to determine the conserve region. Methods of this research are cloning and sequencing of EBA-175 Region III-V. Target gene was amplified using PCR with forward primer GCAAGAAGCAGTTCCTGAGG (5'-3') and reverse primer CCCAGAATTTCCCCCCCG (5'-3'). The DNA template was isolated from a single infected human blood sample by Plasmodium falciparum. E. coli transformation with recombinant plasmid to clone the target gene was using heat shock methods. Colonies selection was done by blue white screening, and to confirm the positive clone, analysis of restriction analysis and PCR colonies was performed. Sequencing result and sequence alignment, to determine conserve region was analysed by DNASTAR. Optimum annealing temperature was obtained by PCR at 65,4oC and the size of the target gene was +-1500 bp. Recombinant plasmids (pGEM-T_EBA-175 RIII-RV) was confirmed with single digest using NcoI. Through sequence alignment, was known that 423 nucleotides are lost from 28 sample sequences which derived from 10 patients. But that nucleotides still appears in 6 sequences of samples from 2 patients. Based on sequence alignment, was obtained that conserve region of region III was from nucleotides number 1 to 45 and 468 to 750.<p align="justify">