CLONING AND SEQUENCING OF HALOAROMATIC DEHALOGENASE GENE FROM Pseudomonas aeruginosa local strain

• Main Author: Ikhsan, Fajri
• Format: Theses
• Language: Indonesia
• Subjects: Kimia
• Online Access: https://digilib.itb.ac.id/gdl/view/38218
• Institution: Institut Teknologi Bandung

Haloaromatic dehalogenase is of interest to be observed because of its ability to degrade haloaromatic compound, a toxic compound accumulated in the environment because of its persistent. Haloaromatic compound is one of organohalogen compound used in chemical industries as pesticides active compound, organic solvents, and plastic precursor. Otherwise, haloaromatic compound has several disadventages characteristics. These compounds are persistent, carcinogenic, and mutagenic. Several haloaromatic compounds have low boiling point, such as PCBs, hence contaminate the environment through water cycle. There are many disruption of health effect caused by haloaromatic exposure, such as respiration disruption, blood circulation disruption, genetic disruption, and in the higest level is death. Therefore, a new biodegrading agent is needed to improve the degradation of haloaromatic compound from the environtment. DNA recombinant technology could be used to increase the bioremediation efficiency. A local strain of Pseudomonas aeruginosa has been identified to be able to degrade haloaromatic compounds, so this microorganism could take place as a haloaromatic bioremediator. In this research, cloning and sequencing of haloaromatic dehalogenase gene from Pseudomonas aeruginosa local strain has been performed utilizing 2-chlorobenzoic acid as the substrate. Part of gene to be cloned is the aromatic hydroxylating dioxygenase ? subunit gene (RHD ? subunit). This part of haloaromatic dehalogenase contains the nucleotides that encoded the active site of this enzyme. The first assay in this research is culturing of P. aeruginosa local strain in the medium contain 2- chlorobenzoic acid. This assay is performed in order to know the result indicated that P. aeruginosa local strain is able to produce the haloaromatic dehalogenase. Haloaromatic dehalogenase is expressed in minimum medium with 0,2% glucose. The 16S rDNA then amplified using universal primers, to confirm that this microorganism is Pseudomonas aeruginosa. The primers used are Bact27F : AGAGTTTGATCATGGCTCAG as forward primer and Uni1492R : GGTTACCTTGTTACGACTT as reverse primer. The amplicon from this process is about 1500 bp. The alignment result of this amplicon sequence shows 99% identity with Pseudomonas aeruginosa PAO1. RHD ? subunit is then amplified using specific primers of F-RHD : GACGTCACTTCCACCCTGAGT as forward primer and R-RHD : TCAGCTGCCGGCCACCTT as reverse primer. This primers are designed based on RHD ? subunit gene of Pseudomonas aeruginosa PAO1H2O from NCBI. The amplicon of this process is about 1.3 kbp. Then, this fragment is cloned into pGEM-T vector and transformed to E. coli TOP10. Recombinant plasmid is isolated, analyzed by agarose gel electrophoresis, confirmed by re-PCR, and the nucleotide sequence is analyzed. The result shows that RHD ? subunit has 1287 bp. Deduced protein of RHD ? subunit shows that 99% identity with GbcA protein, a ring hydroxylating protein, and Rieske [2Fe- 2S] protein from Pseudomonas aeruginosa. Further characterization is performed by motif appearence analysis and classification is done by amino acid sequence alignment. In this clone, Cys-X1-His-X15-17-Cys-X2-His motif appeared at 97, 99, 117, 120 residues, and His-X3-6-His-X148-149-Asp motif appeared at 216, 221, 371 residues. The phyllogenetic tree confirmed that this isolated fragment is belong to haloaromatic group.