POLIMORFISME GLY972ARG GEN IRS-1 DAN G2350A GEN ACE PADA STROKE ISKEMIK

• Main Authors: , Syahrul, dr. Sp.S, , Prof. Dr. dr. Samekto Wibowo, P. Farm(K), Sp S(K), Sp FK(K).
• Format: Theses and Dissertations NonPeerReviewed
• Published: [Yogyakarta] : Universitas Gadjah Mada 2013
• Subjects: ETD
• Online Access: https://repository.ugm.ac.id/122731/; http://etd.ugm.ac.id/index.php?mod=penelitian_detail&sub=PenelitianDetail&act=view&typ=html&buku_id=62835
• Institution: Universitas Gadjah Mada

Stroke is a highly heterogenous multifactorial disorder, and has substantial effect on genetic component of ischemic stroke. Identification of genetic associations as a new risk factor causing ischemic stroke could help greatly in improving strategies of stroke prevention, and can determine target for the latest treatment of ischemic stroke. Identifying Gly972Arg gene IRS-1 and G2350A gene ACE polymorphism as risk factor for ischemic stroke, metabolic syndrome, and insulin resitance in patients with ischemic stroke. Case-control study was conducted by matching the gender and race on 85 cases of patients with ischemic stroke and 86 healthy non-stroke control subjects. For ischemic stroke cases, the following was obtained general physical examination, complete neurology examination, BMI, metabolic syndrome criteria based on ATP III NLHBI 2002, HOMA resistance measurement using HOMA-IR formula, CT-scan or head MRI for ischemic stroke verification, ECG examination, fasting blood glucose measurement, triglyceride level measurement, HDL-cholesterol level measurement, and fasting blood insulin level measurement. DNA isolation followed by PCR-RFLP examination using SmaI enzyme to analyze genotype Gly972Arg gene IRS-1 which use primary 5�CTTCTGTCAG GTGTCCATCC3� and forward �TGGCGAGGTGTCCACGTAGC3� reverse, if there is polymorphism then GGG nucleotides become RGG. For ACE genotype analysis, examination of locus G2350A gene of ACE polymorphism is performed using primary forward 5�- CTGACGAATGTGATGGCCGC-3� upstream and reverse 5�-TTGATGAGTT CCACGTATTTCG- 3� downstream, if there is polymorphism then G nucleotides become A. For control subjects, the same examinations were performed, except head CT scan/MRI. Result of the research for 85 of ischemic stroke cases with average age of 57.3 years old, and 86 control subjects with average age of 44.2 years old was as followed