Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II...

Full description

Saved in:
Bibliographic Details
Main Authors: Wang, Zi-Fu, Li, Ming-Hao, Chu, I-Te, Winnerdy, Fernaldo Richtia, Phan, Anh Tuân, Chang, Ta-Chau
Other Authors: School of Physical and Mathematical Sciences
Format: Article
Language:English
Published: 2020
Subjects:
Online Access:https://hdl.handle.net/10356/145155
Tags: Add Tag
No Tags, Be the first to tag this record!
Institution: Nanyang Technological University
Language: English