Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter
Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II...
Saved in:
Main Authors: | , , , , , |
---|---|
Other Authors: | |
Format: | Article |
Language: | English |
Published: |
2020
|
Subjects: | |
Online Access: | https://hdl.handle.net/10356/145155 |
Tags: |
Add Tag
No Tags, Be the first to tag this record!
|
Institution: | Nanyang Technological University |
Language: | English |